View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20518_high_5 (Length: 512)
Name: NF20518_high_5
Description: NF20518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20518_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 252; Significance: 1e-140; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 15 - 290
Target Start/End: Original strand, 33264276 - 33264551
Alignment:
| Q |
15 |
gagcgaaagaggaggctccaaaacgtcctcgaggtcgtcccagaagactacctcaacaggtagtgtgtatacttttattttgtataaattggttatctca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33264276 |
gagcgaaagaggaggctccaaaacgtcctcgaggtcgtcccagaagactacctcaacaggtagcgtgtatacttttattttgtataaattggttatctca |
33264375 |
T |
 |
| Q |
115 |
ttttcaaatgtgtacattaatctcctaagaggattgaataattaagaccatatggctaaatttgtgttgctccagggagagaaagaggaggaagcaccaa |
214 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
33264376 |
ttttcaaatgtgtacattaatctcccaagaggattgaataattaagaccatatggctaaatttgtgttgctccagggagagaaagaggaggaggccccaa |
33264475 |
T |
 |
| Q |
215 |
aatattgtgggcgcggtcgtccaccaaaacgagttgaacatgcacatgaaccacctacgctcgcaaaggtagcatc |
290 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33264476 |
aatattgtgggcgtggtcgtccaccaaaacgagttgaacatgcacatgaaccacctactctcgcaaaggtagcatc |
33264551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 142; E-Value: 3e-74
Query Start/End: Original strand, 336 - 496
Target Start/End: Original strand, 33264597 - 33264755
Alignment:
| Q |
336 |
attggggatctcatcatatacaaatgtcatgtgtacgttaaaaagataattagatgtgagccaaaaatgagattataaagattcttatgcttgatttgtt |
435 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33264597 |
attggggatctcatcatatacaaatgtcatttgtac--taaaaagataattagatgtgagccaaaaatgagattataaagattcttatgcttgatttgtt |
33264694 |
T |
 |
| Q |
436 |
tgtgtagatgcaaaagaccggagagagttcttttggagcagggaatgctggagcatcttct |
496 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33264695 |
tgtgtagatgcaaaagaccggagagagttgttttggagcagggaatgctggagcatcttct |
33264755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University