View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20519_high_50 (Length: 242)
Name: NF20519_high_50
Description: NF20519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20519_high_50 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 42 - 231
Target Start/End: Complemental strand, 55696166 - 55695975
Alignment:
| Q |
42 |
ttgaggcaataatgtagagatcttaatcagtgatcttgaccattgataatatggagatcaatggttaagatcacctcattatttcctcaagnnnnnnnnc |
141 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |
|
|
| T |
55696166 |
ttgaggaaataatgtagagatcttaatcactgatcttgaccattgataatatggagatcaatggttaagatctcctcattatttcctcaagttttttttc |
55696067 |
T |
 |
| Q |
142 |
ccaattgagagaatccatttccctagtttctatgggat--ccctatgaatttcaaatttcagtcagtaaatagtgttttagagattgtgatg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55696066 |
ccaattgagagaatccatttccctagtttctatgggatatccctatgaatttcaaatttcagtcagtaaatagtgttttagagattgtgatg |
55695975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 73 - 114
Target Start/End: Original strand, 7898163 - 7898204
Alignment:
| Q |
73 |
gatcttgaccattgataatatggagatcaatggttaagatca |
114 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
7898163 |
gatcttgaccattgataatgtggagatcaatggtcaagatca |
7898204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 81 - 113
Target Start/End: Original strand, 26919500 - 26919532
Alignment:
| Q |
81 |
ccattgataatatggagatcaatggttaagatc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26919500 |
ccattgataatatggagatcaatggttaagatc |
26919532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University