View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20519_high_53 (Length: 239)
Name: NF20519_high_53
Description: NF20519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20519_high_53 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 27923660 - 27923881
Alignment:
| Q |
18 |
acggatggcccactccttgacttcataaactcttgattaggtccacaagctgaggtggcttgcatgattgattcatttggtaatatatttacacaatttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27923660 |
acggatggcccactccttgacttcataaactcttgattaggtccataagctgaggtggcttgcatgattgattcatttggtaatatagttacacaatttg |
27923759 |
T |
|
| Q |
118 |
attgttgagaagatgatgcatggtcgaccttccttgttcgtgcatgatgtctatctactttgaggaagagcaaaacttcttctgcatggaagtaatcact |
217 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
27923760 |
attgttgagaagaggatgcatggtcgaccttccttgtttgtgcatgatgtctatctactttgaggaagagcaaaacttcttcagcatggaagtactcact |
27923859 |
T |
|
| Q |
218 |
ttttggtgcatgttataatcct |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
27923860 |
ttttggtgcatgttataatcct |
27923881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University