View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20519_high_54 (Length: 238)
Name: NF20519_high_54
Description: NF20519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20519_high_54 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 11894722 - 11894499
Alignment:
| Q |
1 |
caggattcgtacctcctcaatcatggaagccaagatagcaaattcaaaatttcaggtgagataaaatttctataccaaacttaatttaacccatcaagga |
100 |
Q |
| |
|
|||| ||| ||||||||||||||||| |||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11894722 |
cagggttcatacctcctcaatcatgggagccaacatagcaatttcaaaatttcaggtgagataaaatttctataccaaacttaatttaacccattaagga |
11894623 |
T |
 |
| Q |
101 |
atgaaaccaacagag--gtaacacatttcaaaaattaatttgcataatgaatgtcctaagtctctaattagggggatatacaaatcccttaatttgctgc |
198 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11894622 |
atgaaaccaacatagatgtaacacatttcaaaaattaatttgcataatgaatgtcctaagtctctaattagggggatatacaaatcccttaatttgctgc |
11894523 |
T |
 |
| Q |
199 |
ttgaaataatccttctcagcatta |
222 |
Q |
| |
|
||||||||||||||||| |||||| |
|
|
| T |
11894522 |
ttgaaataatccttctctgcatta |
11894499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University