View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20519_high_63 (Length: 230)
Name: NF20519_high_63
Description: NF20519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20519_high_63 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 105 - 210
Target Start/End: Complemental strand, 11213323 - 11213218
Alignment:
| Q |
105 |
tcgactctggtctagaccaaaacatattccacgaacccgcctgactcgaccatgtatactgcctcatctgcccaaacggctcaaccctaaacatcgtagg |
204 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11213323 |
tcgactccggtctagaccaaaacatattccaggaacctgcctgactcgaccatgtatactgcctcatctgcccaaacggctcaaccctaaacatcgtagg |
11213224 |
T |
 |
| Q |
205 |
cggtct |
210 |
Q |
| |
|
|||||| |
|
|
| T |
11213223 |
cggtct |
11213218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University