View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20519_high_72 (Length: 202)
Name: NF20519_high_72
Description: NF20519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20519_high_72 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 10 - 202
Target Start/End: Original strand, 6314855 - 6315047
Alignment:
| Q |
10 |
gcagaacctgtgaccgttagggaattaaaagcacacaagtggattgcaaaaagggacagaagtcactctttcccttcctacacacagcacctcctaaggc |
109 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6314855 |
gcagaacctgtgactgttagggaattaaaagcacacaagtggattgcaaaaagggccagaagtcactctttcccttcctacacacagcacctcctaaggc |
6314954 |
T |
 |
| Q |
110 |
atatcttctttgaatggcaagaaactacaacagcttaggggaatagtgacctatgacctcaaattcaaacgcatgcaggggacattttcatca |
202 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6314955 |
atatcttctttgaatggcaagagactacaacagcttaggggaatagtaacctatgacctcaaattcaaacgcatgcaggggacattttcatca |
6315047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University