View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20519_high_8 (Length: 492)
Name: NF20519_high_8
Description: NF20519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20519_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 449; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 449; E-Value: 0
Query Start/End: Original strand, 13 - 485
Target Start/End: Original strand, 47523171 - 47523642
Alignment:
| Q |
13 |
tgaattgcatacattacattttttgcgagagataatgatgtatcaactgtttagttctagctatatggtttgctagtgaattatgtaaagaattgagttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47523171 |
tgaattgcatacattacattttttgcgagagataatgatgtatcaactgtttagttctagctatatggtt-gctagtgaattatgtaaagaattgagttt |
47523269 |
T |
 |
| Q |
113 |
ttgttgatgttgtcgtcgtcgtcgacttgatttatgattgaattggcgtgtgacatgtttgatggtaagatagaaaccattcagagtggatcgaggagca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47523270 |
ttgttgatgttgtcgtcgtcgtcgacttgatttatgattgaattggcgtgtgacatgtttgatggtaagatagaaaccgttcagagtggatcgaggagca |
47523369 |
T |
 |
| Q |
213 |
gagtggctgacctccaaagcggtatagaggatagtgaccaatatttaggacattcttaattaataatagaagtttatcttgattattttcaagtaattgg |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47523370 |
gagtggctgacctccaaagcggtatagaggatagtgaccaatatttaggacattcttaattaataatagaagtttatcttgattattttcaagtaattgg |
47523469 |
T |
 |
| Q |
313 |
attggatttttatttgtgttaaggtggtctgctgtttgaacaggaaatgaaaattgccttgctctttcaatttgtccttcagttggtctaggggcttttt |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47523470 |
attggatttttatttgtgttaaggtggtctggtgtttgaacaggaaatgaaaattgccttgctctttcaatttgtccttcagttggtctaggggcttttt |
47523569 |
T |
 |
| Q |
413 |
gtattgattgtaatctagtttggattggatcatattggtgagtctgatctggggtggtttcattgcgctccaa |
485 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
47523570 |
gtattgattgtaatctagtttggattggatcatattggtgaatctgatctggggtggtttcattgtgctccaa |
47523642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University