View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20519_low_44 (Length: 253)
Name: NF20519_low_44
Description: NF20519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20519_low_44 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 10 - 253
Target Start/End: Original strand, 40639027 - 40639268
Alignment:
| Q |
10 |
tccaagaatatgtgtgtctatcagatattatacttgttttttaatattattcttttactttaaaaaataatttttgcgtctattggatagatatttcatg |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40639027 |
tccaataatatgtgtgtctatcagatattatacttgttttttaatattattcttttaatttaaaaaataatttttgcgtctattggatagatatttcatg |
40639126 |
T |
 |
| Q |
110 |
gggtcaaaataagccatatttcnnnnnnnnnnnnnnnnncttcaaatataaactcttgtgatcgactttgatttggtatactgagagtggaaaaaacata |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40639127 |
gggtcaaaataagccatatttcttttttgcaatttttttcttcaa--ataaactcttgtgatcgactttgatttggtatactgagagtggaaaaaacata |
40639224 |
T |
 |
| Q |
210 |
ctgtacttaattgcatgggattcagaaatagatggaattgctca |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40639225 |
ctgtacttaattgcatgggattcagaaatagatggaattgctca |
40639268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University