View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20519_low_44 (Length: 253)

Name: NF20519_low_44
Description: NF20519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20519_low_44
NF20519_low_44
[»] chr5 (1 HSPs)
chr5 (10-253)||(40639027-40639268)


Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 10 - 253
Target Start/End: Original strand, 40639027 - 40639268
Alignment:
10 tccaagaatatgtgtgtctatcagatattatacttgttttttaatattattcttttactttaaaaaataatttttgcgtctattggatagatatttcatg 109  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
40639027 tccaataatatgtgtgtctatcagatattatacttgttttttaatattattcttttaatttaaaaaataatttttgcgtctattggatagatatttcatg 40639126  T
110 gggtcaaaataagccatatttcnnnnnnnnnnnnnnnnncttcaaatataaactcttgtgatcgactttgatttggtatactgagagtggaaaaaacata 209  Q
    ||||||||||||||||||||||                 ||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||    
40639127 gggtcaaaataagccatatttcttttttgcaatttttttcttcaa--ataaactcttgtgatcgactttgatttggtatactgagagtggaaaaaacata 40639224  T
210 ctgtacttaattgcatgggattcagaaatagatggaattgctca 253  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
40639225 ctgtacttaattgcatgggattcagaaatagatggaattgctca 40639268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University