View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20519_low_49 (Length: 247)
Name: NF20519_low_49
Description: NF20519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20519_low_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 14333894 - 14334146
Alignment:
| Q |
1 |
cttaggatcagggctaaagctgctgtttctctatccaaatgtgtctccaaaatggtaaagtttgccactccatttgaattatgatatgatgtagtgttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14333894 |
cttaggatcagggctaaagctgctgtttctctatccaaatgtgtctccaaaatggtaaagtttggtactccatttgaattatgatatgatgtagtgttat |
14333993 |
T |
 |
| Q |
101 |
ttattt------------tgatacatggtctaggtagaaagttttatactgtcaacaaatcacaaccaattaacgatccgatggtgtatatgaattaaat |
188 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
14333994 |
ttattttgagtttaattttgatacatggtctaggtagaaagttttatactgtcaacaaatcacaaccaattaacgatccgatggtgtatatgaattatat |
14334093 |
T |
 |
| Q |
189 |
caatttgttttattggtgtttttgggtttgtgtatgtttctaacgagtattat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
14334094 |
caatttgttttattggtgtttttgggtttatgtatgtttctaaagagtattat |
14334146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University