View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20519_low_59 (Length: 238)
Name: NF20519_low_59
Description: NF20519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20519_low_59 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 18 - 151
Target Start/End: Complemental strand, 256628 - 256495
Alignment:
| Q |
18 |
gagccatcacccatggcaatgtcagcacaccagcaccaatcactgccgttatgatatgcgcggctgccgtccataatgtccctgtggtttaaaaggaaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
256628 |
gagccatcacccatggcaatgtcagcacaccagcaccaatcactgccgttatgatatgcgcggctgcggtccataatgtccctgtggtttaaaaggaaac |
256529 |
T |
 |
| Q |
118 |
caggtctgagttgagtgtatagatgaacttgcac |
151 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
256528 |
caggattgagttgagtgtatagatgaacttgcac |
256495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 18 - 69
Target Start/End: Original strand, 227675 - 227726
Alignment:
| Q |
18 |
gagccatcacccatggcaatgtcagcacaccagcaccaatcactgccgttat |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
227675 |
gagccatcacccatggcaatgtcagcacaccagcaccaatcactgccgttat |
227726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 167 - 226
Target Start/End: Original strand, 228136 - 228195
Alignment:
| Q |
167 |
taacgaattcatggtgctattgaggaaattttatatatgtagatacaaccacatcaggtc |
226 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
228136 |
taacgaaatcatggtgcttttgaggaaattttatatatgtagatacaaccacatcaggtc |
228195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 256182 - 256124
Alignment:
| Q |
153 |
aatcaagaagaatttaacgaattcatggtgctattgaggaaattttatatatgtagatac |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||| |||||||| |||||||| |
|
|
| T |
256182 |
aatcaagaagaatttaaggaattcatggtgctattga-gaaaatttatatacgtagatac |
256124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University