View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20519_low_62 (Length: 235)
Name: NF20519_low_62
Description: NF20519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20519_low_62 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 15 - 217
Target Start/End: Original strand, 37625020 - 37625225
Alignment:
| Q |
15 |
aatattgaatgagggaggctgctttaattttatatatgcaattattttgagcacatgcagtgtagttgcatctaatttttatcatccaccctgtaaacta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37625020 |
aatattgaatgagggaggctgctttaattttatatatgcaattattttgagcacatgcagtgtagttgcatctaatttttatcatccaccctgtaaacta |
37625119 |
T |
 |
| Q |
115 |
tgaagaatatatgccatttctcttgcnnnnnnnnnnnnnnnnnnnattggctgagaaaaatatg---taatatacattgcatcttgcttctttctggtat |
211 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37625120 |
tgaagaatatatgccatttctcttgcttttttgtttttcatttttattggctgagaaaaatatgtattaatatacattgcatcttgcttctttctggtat |
37625219 |
T |
 |
| Q |
212 |
ttctct |
217 |
Q |
| |
|
|||||| |
|
|
| T |
37625220 |
ttctct |
37625225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University