View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20519_low_68 (Length: 226)
Name: NF20519_low_68
Description: NF20519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20519_low_68 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 164
Target Start/End: Original strand, 31458123 - 31458286
Alignment:
| Q |
1 |
ttaatcatttcacccaagcaacatcacaaatctactcctccactgtcttaagacttgtttaaacaatacctgtgcagattcttagaagaaacaaattgtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31458123 |
ttaatcatttcacccaagcaacatcacaaatctactcctcctctgtcttaagacttgtttaaacaatacctgtgcagattcttagaagaaacaaattgtg |
31458222 |
T |
 |
| Q |
101 |
ttgggatgtgtattaatctctgcaaaatgccatctcaattgttcataaaggactcgtttggtat |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31458223 |
ttgggatgtgtattaatctctgcaaaatgccatctcaattgttcataaaggactcgtttggtat |
31458286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 31457989 - 31457938
Alignment:
| Q |
157 |
tttggtattggcaattactttgataaagatcataaatcatgatagttagtgt |
208 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31457989 |
tttggtattggcaattactttgataatgatcataaatcatgatagttagtgt |
31457938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 157 - 200
Target Start/End: Complemental strand, 31467883 - 31467840
Alignment:
| Q |
157 |
tttggtattggcaattactttgataaagatcataaatcatgata |
200 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
31467883 |
tttggtattggcaataactttgataatgatcataaatcatgata |
31467840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University