View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20519_low_72 (Length: 205)
Name: NF20519_low_72
Description: NF20519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20519_low_72 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 10 - 186
Target Start/End: Original strand, 39969239 - 39969415
Alignment:
| Q |
10 |
acatcatcactcttttcctgaactcatgaacaattcgagatttggaatcaattgcagacccagtgtttgataaaatgccactgagaatgtagagtttacg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39969239 |
acatcatcactcttttcctgaactcatgaacaattcgagatttggaatcaattgcagacccagtgtttgataaaatgccactgagaatgtagagtttacg |
39969338 |
T |
 |
| Q |
110 |
aagcgaaccgtcaaagaagatctgacagtgacgtttactaacacgacggtcgttgaagacgaaatggcagtcgtgac |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39969339 |
aagcgaaccgtcaaagaagatctgacagtgacgtttactaacacgacggtcgttgaagacgaaatgacagtcgtgac |
39969415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University