View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2051_low_10 (Length: 251)
Name: NF2051_low_10
Description: NF2051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2051_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 11025501 - 11025259
Alignment:
| Q |
1 |
acgttagctatcattacatctctgatacctaaatatgcaaacaacgcagacgtaagtggatcacttgattgttgcaagcaacaatatgaaatgatgcccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
11025501 |
acgttagctatcattacatctctgatacctaaatatgcaaacaacgcagacgtaagtggatcacttgattgttgcaagcaacaatatgaaatgatgcctg |
11025402 |
T |
 |
| Q |
101 |
attctataaccaatgccgttgcggccctcgctgtgcgcaatgctcaagaagtaaatgcccaatttagcgcgattctttcataccatacctcttgtgtaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11025401 |
attctataaccaatgccgttgcggccctcgctgtgcgcaatgctcaagaagtaaatgctcaatttagcgggattctttcataccatacctcttgtgtaga |
11025302 |
T |
 |
| Q |
201 |
tacttttgctgagagtactgattatcctgttgcaccctttgct |
243 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11025301 |
tacttttgctgagagtaatgattatcctgttgcaccctttgct |
11025259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University