View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20520_high_4 (Length: 385)
Name: NF20520_high_4
Description: NF20520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20520_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 79 - 375
Target Start/End: Original strand, 46752389 - 46752681
Alignment:
| Q |
79 |
atagtaaggagtgcaaactattttgtcatgttttagggttgtggcaaaagacactgtttcgtatttcttttaacataatatgggtctcagaaagcttcag |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46752389 |
atagtaaggagtgcaaactattttgtcatgttttagggttgtggcaaaagacactggttcgtatttcttttaacata----gggtctcagaaagcttcag |
46752484 |
T |
 |
| Q |
179 |
tgcatggtcactatttggattggaaccttctttgcaatcatggctgttaatactagctgatacagttgttaatgaagctactgatattttgttttattct |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46752485 |
tgcatggtcactatttggattggaaccttctttgcaatcatggctgttaatactagctgatacagttgttaatgaagctgctgatattttgttttattct |
46752584 |
T |
 |
| Q |
279 |
aaattctaaaagatcttttttcagctaaattttatataaataaatctatcaatcttttagatttttgtgggtgcaatcttaccagaacccttcatct |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46752585 |
aaattctaaaagatcttttttcagctaaattttatataaataaatctatcaatcttttagatttttgtgggtgcaatcttaccagaacccttcatct |
46752681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University