View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20520_low_1 (Length: 279)
Name: NF20520_low_1
Description: NF20520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20520_low_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 11 - 178
Target Start/End: Complemental strand, 33541046 - 33540879
Alignment:
| Q |
11 |
cagagattagtcgattattgatttaggtgatgaatagtcgatggttaattgactaggaaatgtagttaatcaattaggttaaatgaaaatgtataaactt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33541046 |
cagagattagtcgattattgatttaggtgatgaatagtcgatggttaattgactaggaaatgtagttaatcaattaggttaaatgaaaatgtataaactt |
33540947 |
T |
 |
| Q |
111 |
gtctaagtgttaatatgagatgttgagtagatcattatagattaggttaagtagaaaatcacttttgc |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33540946 |
gtctaagtgttaatatgagatgttgagtagatcattatagattaggttaagtaaaaaatcacttttgc |
33540879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University