View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20521_high_15 (Length: 261)
Name: NF20521_high_15
Description: NF20521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20521_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 20 - 201
Target Start/End: Original strand, 1817654 - 1817835
Alignment:
| Q |
20 |
tactattttaggatcaaaatcataacatcttgttaagcaccctgttgaataagtggcacctgtgaaattactgttgagatatccgtaactgtcacaacca |
119 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1817654 |
tactattttaggtttaaaatcataacatcttgttaagcaccctgttgaataagtgccacctgtgaaattactgttgagatatccgtaactgtcgcaacca |
1817753 |
T |
|
| Q |
120 |
acggttatgaatttgttttccgtacttgaaattgtgtgaggagaaacaatgagataagctctatttgcttcttcagtattat |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1817754 |
acggttatgaatttgttttccgtacttgaaattgtgtgaggagaaactatgagataagctctatttgcttcttcagtattat |
1817835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 24 - 201
Target Start/End: Complemental strand, 1855533 - 1855356
Alignment:
| Q |
24 |
attttaggatcaaaatcataacatcttgttaagcaccctgttgaataagtggcacctgtgaaattactgttgagatatccgtaactgtcacaaccaacgg |
123 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
1855533 |
attttagtatcaaaatcataacatcttgttaagcatcctgtagaataagtggcacccttgaaattactgttgagatatccgaaactgtcacaaccaactg |
1855434 |
T |
|
| Q |
124 |
ttatgaatttgttttccgtacttgaaattgtgtgaggagaaacaatgagataagctctatttgcttcttcagtattat |
201 |
Q |
| |
|
||||||||||||| || || |||||||||| | | | |||||| ||||| ||| | ||||||||| ||| ||||||| |
|
|
| T |
1855433 |
ttatgaatttgttgtctgtgcttgaaattgcgagggaagaaactctgagagaaggtttatttgctttttcggtattat |
1855356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 40 - 148
Target Start/End: Original strand, 9220511 - 9220619
Alignment:
| Q |
40 |
cataacatcttgttaagcaccctgttgaataagtggcacctgtgaaattactgttgagatatccgtaactgtcacaaccaacggttatgaatttgttttc |
139 |
Q |
| |
|
||||||||||||||||||| || |||||||| || | | || || ||||||||||||| |||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
9220511 |
cataacatcttgttaagcaaccggttgaatatgtttcttcgttgtaaatactgttgagataaccgtaactgtcacaaccaaccgttatgaacttgttttc |
9220610 |
T |
|
| Q |
140 |
cgtacttga |
148 |
Q |
| |
|
|| ||||| |
|
|
| T |
9220611 |
agtgcttga |
9220619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 89 - 138
Target Start/End: Original strand, 9158110 - 9158159
Alignment:
| Q |
89 |
actgttgagatatccgtaactgtcacaaccaacggttatgaatttgtttt |
138 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||| ||| ||||||| |
|
|
| T |
9158110 |
actgttgagataaccgtaactgtcacaaccaaccgttacgaacttgtttt |
9158159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 219 - 251
Target Start/End: Original strand, 1817853 - 1817885
Alignment:
| Q |
219 |
ttcgaacaaagatgtgagactgaaaatttcatt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1817853 |
ttcgaacaaagatgtgagactgaaaatttcatt |
1817885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 24 - 155
Target Start/End: Complemental strand, 37567008 - 37566870
Alignment:
| Q |
24 |
attttaggatcaaaatcataacatcttgttaa-------gcaccctgttgaataagtggcacctgtgaaattactgttgagatatccgtaactgtcacaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37567008 |
attttaggatcaaaatcataacatcttgttaactgttaagcatcctgtagaataagtggcacccttgaaattactgttgagatatccgtaactgtcgcaa |
37566909 |
T |
|
| Q |
117 |
ccaacggttatgaatttgttttccgtacttgaaattgtg |
155 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37566908 |
ccaacggttatgaatttgttttccgtgcttgaaattgtg |
37566870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University