View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20521_high_16 (Length: 260)
Name: NF20521_high_16
Description: NF20521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20521_high_16 |
 | |
|
| [»] scaffold0018 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 6169600 - 6169366
Alignment:
| Q |
1 |
tctggtgccgatctgtttgagaaataggtggcacaactgctttctgacaagttttcagatgatttcttcgcatatattccggtagaggaatagctgtgcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6169600 |
tctggtgccgatctgtttgagaaataggtggcacaactgctttctgacaggttttcagatgatttcttcgcatatattccggtagaggaatagctgtgcg |
6169501 |
T |
|
| Q |
101 |
gacggtctcatggtcagagtattcagggtgtttggtggtccactgctcttcctgatgttatttgggaaccgttcttctcggaccgtttcggttagcctaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6169500 |
gacggtctcatggtcagagtattcagggtgtttggtggtccactgctcttcctgatgttattcgggaaccgttcttttcggaccgtttcggttagcctaa |
6169401 |
T |
|
| Q |
201 |
ataccgttttccttcattttgtttatgttttcttc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
6169400 |
ataccgttttccttcattttgtttatgttttcttc |
6169366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 32879617 - 32879858
Alignment:
| Q |
1 |
tctggtgccgatctgtttgagaaataggtggcacaactgctttctgacaagttttcagatgatttcttcgcatatattccggtagaggaatagctgtgcg |
100 |
Q |
| |
|
||||||||||||| |||||| ||| | |||||||| |||||||||||| |||||||| ||||||||||||||||||| ||| || ||||||| |||||| |
|
|
| T |
32879617 |
tctggtgccgatccgtttgaaaaaccgatggcacaattgctttctgacatgttttcaggtgatttcttcgcatatattacgggaggggaatagttgtgcg |
32879716 |
T |
|
| Q |
101 |
gacggtc-------tcatggtcagagtattcagggtgtttggtggtccactgctcttcctgatgttatttgggaaccgttcttctcggaccgtttcggtt |
193 |
Q |
| |
|
|| |||| ||||||||| | |||||||||||||||||||||||| |||||||| ||| ||||| || ||||||| || ||||||||| ||| |
|
|
| T |
32879717 |
gatggtcgtgctaatcatggtcacaatattcagggtgtttggtggtccaccgctcttccagattttattcagggttcgttcttttcagaccgtttcagtt |
32879816 |
T |
|
| Q |
194 |
agcctaaataccgttttccttcattttgtttatgttttcttc |
235 |
Q |
| |
|
||||||||| |||||||||| |||| ||| |||||||||| |
|
|
| T |
32879817 |
ggcctaaatatcgttttccttaatttaatttttgttttcttc |
32879858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 108 - 235
Target Start/End: Original strand, 14103209 - 14103335
Alignment:
| Q |
108 |
tcatggtcagagtattcagggtgtttggtggtccactgctcttcctgatgttatttgggaaccgttcttctcggaccgtttcggttagcctaaataccgt |
207 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||| ||||||||| |||| ||||| || || ||||||||||||| ||||||||| ||| |
|
|
| T |
14103209 |
tcatggtcacagtactcagggtgtttggtggtccactgctcttctagatgttattcgggatccgttttt-tcagaccgtttcggttggcctaaatatcgt |
14103307 |
T |
|
| Q |
208 |
tttccttcattttgtttatgttttcttc |
235 |
Q |
| |
|
||||||| |||||||||||||||||||| |
|
|
| T |
14103308 |
tttccttaattttgtttatgttttcttc |
14103335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 14103127 - 14103203
Alignment:
| Q |
1 |
tctggtgccgatctgtttgagaaataggtggcacaactgctttctgacaagttttcagatgatttcttcgcatatat |
77 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||| |||| |||| ||||| || ||||||||||| |||||| |
|
|
| T |
14103127 |
tctggtgccgatccgtttgagaaacaggtggcacaactgttttccgacaggttttaaggtgatttcttcgaatatat |
14103203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 3 - 220
Target Start/End: Original strand, 153185 - 153410
Alignment:
| Q |
3 |
tggtgccgatctgtttgagaaataggtggcacaactgctttctgacaagttttcagatgatttcttcgcatatattccggtagaggaatagctgtgcgga |
102 |
Q |
| |
|
||||||||||| |||||||||| ||||| |||||||||||| ||| |||||||| || |||||||||||||||| | | || ||||||| |||||||| |
|
|
| T |
153185 |
tggtgccgatccgtttgagaaacaggtgccacaactgcttttcaacaggttttcaggtggtttcttcgcatatatttcaggaggggaatagttgtgcgga |
153284 |
T |
|
| Q |
103 |
cggtc-------tcatggtcagagtattcagggtgt-ttggtggtccactgctcttcctgatgttatttgggaaccgttcttctcggaccgtttcggtta |
194 |
Q |
| |
|
|||| | ||||||| |||||||||| ||| |||||| ||||||| |||||| || ||||| ||| |||||||| || |||| ||||||||| |
|
|
| T |
153285 |
tggtctagctaataatggtcacagtattcaggatgtgttggtgatccactgttcttccatattttattcaggagccgttcttttcagaccatttcggtta |
153384 |
T |
|
| Q |
195 |
gcctaaataccgttttccttcatttt |
220 |
Q |
| |
|
||||||||| ||||| ||| ||||| |
|
|
| T |
153385 |
gcctaaatattgtttttctttatttt |
153410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 41444028 - 41443870
Alignment:
| Q |
1 |
tctggtgccgatctgtttgagaaataggtggcacaactgctttctgacaagttttcagatgatttcttcgcatatattccggtagaggaatagctgtgcg |
100 |
Q |
| |
|
||||||| |||| |||||||||| ||||||||||||||||| | |||| |||||||| ||||| |||| |||||||||||| || ||||||| |||||| |
|
|
| T |
41444028 |
tctggtgttgatccgtttgagaaacaggtggcacaactgcttaccgacaggttttcaggtgattccttcacatatattccgggaggggaatagttgtgcg |
41443929 |
T |
|
| Q |
101 |
gacggtc-------tcatggtcagagtattcagggtgtttggtggtccactgctcttcc |
152 |
Q |
| |
|
|| ||| |||| |||| ||||||| |||||||||||||||||| ||||||| |
|
|
| T |
41443928 |
gatagtccagctaatcatcgtcaccgtattcaaggtgtttggtggtccactactcttcc |
41443870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University