View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20521_high_34 (Length: 214)
Name: NF20521_high_34
Description: NF20521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20521_high_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 16 - 197
Target Start/End: Original strand, 23470511 - 23470697
Alignment:
| Q |
16 |
tatatgtgttaaattaaggaaaggaacagaaaacaacatatgaaaattttctttt-----ggatggctacatgcagattttaattcgttttggttaacaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23470511 |
tatatgtgttaaattaaggaaaggaacagaaaacaacatatgaaatttttcttttaatttggatggctacatgcagattttaattctttttggttaacaa |
23470610 |
T |
|
| Q |
111 |
aaacatcatctgcgtcgaactgtaaatattaatcatcatgagagaactaagattcatttaagaggttgatctcttcctacaaatatt |
197 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||| || |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23470611 |
aaacatcatctgcgtggaaccgtaaatattaatcatcatgagaaaattaagattcatttaagaggttgacctcttcctacaaatatt |
23470697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University