View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20521_high_8 (Length: 325)

Name: NF20521_high_8
Description: NF20521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20521_high_8
NF20521_high_8
[»] chr8 (1 HSPs)
chr8 (176-309)||(2367704-2367837)


Alignment Details
Target: chr8 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 176 - 309
Target Start/End: Original strand, 2367704 - 2367837
Alignment:
176 aataaccagatttggtaattaacccaactaacccattcatgcatgcttttctttatttaaataaataaccagtattaaatatgccaaataagatcacaca 275  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2367704 aataaccagatttggtaattaacccaactaacccattcatgcatgcttttctttatttaaataaataaccagtattaaatatgccaaataagatcacaca 2367803  T
276 atgaaggaaaataaatgtgtgaaatatgtcacat 309  Q
    ||||||||||||||||||||||||||||||||||    
2367804 atgaaggaaaataaatgtgtgaaatatgtcacat 2367837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University