View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20521_high_8 (Length: 325)
Name: NF20521_high_8
Description: NF20521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20521_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 176 - 309
Target Start/End: Original strand, 2367704 - 2367837
Alignment:
| Q |
176 |
aataaccagatttggtaattaacccaactaacccattcatgcatgcttttctttatttaaataaataaccagtattaaatatgccaaataagatcacaca |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2367704 |
aataaccagatttggtaattaacccaactaacccattcatgcatgcttttctttatttaaataaataaccagtattaaatatgccaaataagatcacaca |
2367803 |
T |
 |
| Q |
276 |
atgaaggaaaataaatgtgtgaaatatgtcacat |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2367804 |
atgaaggaaaataaatgtgtgaaatatgtcacat |
2367837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University