View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20521_low_13 (Length: 287)
Name: NF20521_low_13
Description: NF20521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20521_low_13 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 12 - 287
Target Start/End: Original strand, 50101113 - 50101384
Alignment:
| Q |
12 |
acagaacagaacacaacaacatatcagtgcaaaacaattctcaaaactctttctttttctctcaacaactttttcaaagtaataataatcacttgttgcg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50101113 |
acagaacagaacacaacaacatatcagtgcaaaacaattctcaaaactctctctttttctctcaacaactttttcaaagtaataataatcacttgttgcg |
50101212 |
T |
|
| Q |
112 |
cgggaaagcgcttcttatcaatccnnnnnnnnnnnnnnnnnactcgttcgttccttcgttcaccgtgaaactattcagttacggttgcgaaagaggaacg |
211 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50101213 |
cgggaaagcgcttcttatcaatc----tctctctctctctcactcgttcgttccttcgttcaccgtgaaactattcagttacggttgcgaaagaggaacg |
50101308 |
T |
|
| Q |
212 |
ataacaatgcaaaccattgaagaagaagaagctgttggaagcgatgttcaggattctccttcacatttcgagattt |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50101309 |
ataacaatgcaaaccattgaagaagaagaagctgttggaagcgatgttcaggattctccttcacatttcgagattt |
50101384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University