View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20522_low_12 (Length: 304)
Name: NF20522_low_12
Description: NF20522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20522_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 20 - 238
Target Start/End: Original strand, 40696338 - 40696554
Alignment:
| Q |
20 |
ctcaccgtgttttaagctcttcttcaaattcatagatagtgaaagagaaaaaataaaagatagtgttaacgtgcgcatccgtgtggcgcaggatatggaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40696338 |
ctcaccgtgttttaagctcttcttcaaattcatagatagtgaaagagaaaaaa--aaagatagtgttaacgtgcgcatccttgtggcgcaggatatggaa |
40696435 |
T |
 |
| Q |
120 |
tcacctaccttcgtttcaaaagcgaggacagccttcaattccgctgctgcaaaagcggaacgtgttcttctcgacttcaaatcagatcgaggtgaggttc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40696436 |
tcacctaccttcgtttcaaaagcgaggacagccttcaattccgctgctgcaaaagcggaacgtgttcttctcgacttcaaatcagatcgaggtgaggttc |
40696535 |
T |
 |
| Q |
220 |
tcttcattccacgtcatac |
238 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40696536 |
tcttcattccacgtcatac |
40696554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University