View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20522_low_14 (Length: 278)
Name: NF20522_low_14
Description: NF20522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20522_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 7089826 - 7090031
Alignment:
| Q |
1 |
attacctgcttcagtgatatagggaaagtgatccaaccacactgttcaagtgtcttcacaacaccctttgttatgtctctccataatctacaaactgagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7089826 |
attacctgcttcagtgatatagggaaagtgatccaaccacactgttcaagtgtcttcacaacaccctttgttatgtctctccataatctacaaactgagg |
7089925 |
T |
 |
| Q |
101 |
cacaagctacaagtgcgcggcgagatggccaagaggtttcactagcttccaccctttgaattatgtctaatagtaactcgggaggtaaattagcccattg |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7089926 |
cacaagctacaagtgcacggcgagatggccaagaggtttcactagcttccaccctttgaattatgtctaatagtaactcgggaggtaaattagcccattg |
7090025 |
T |
 |
| Q |
201 |
actctg |
206 |
Q |
| |
|
|||||| |
|
|
| T |
7090026 |
actctg |
7090031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 7669652 - 7669857
Alignment:
| Q |
1 |
attacctgcttcagtgatatagggaaagtgatccaaccacactgttcaagtgtcttcacaacaccctttgttatgtctctccataatctacaaactgagg |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7669652 |
attacctgcttcaatgatatagggaaagtgatccaaccacactgttcaagtgtcttcacaacaccctttgttatgtctctccacaatctacaaactgagg |
7669751 |
T |
 |
| Q |
101 |
cacaagctacaagtgcgcggcgagatggccaagaggtttcactagcttccaccctttgaattatgtctaatagtaactcgggaggtaaattagcccattg |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
7669752 |
cacaagctacaagtgcgcggagagatggccaagtggtttcactagcttccaccctttgaattatgtctaatagtaactcaggaggtaagttagcccattg |
7669851 |
T |
 |
| Q |
201 |
actctg |
206 |
Q |
| |
|
|||||| |
|
|
| T |
7669852 |
actctg |
7669857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University