View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20522_low_21 (Length: 223)
Name: NF20522_low_21
Description: NF20522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20522_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 53697008 - 53697215
Alignment:
| Q |
1 |
gatcatatatatcaatccaatcataaattaatcaatattgatgaaacttgttaattacatgtacggatgttgatgtatagagttgaaataaaaatgaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53697008 |
gatcatatatatcaatccaatcataaattaatcaatattgatgaaacttgttaattacatgtacggatgttgatgtatagagttgaaataaaaatgaagt |
53697107 |
T |
 |
| Q |
101 |
agttacatgatgacatcaatgatagatgaaagtattgattgtcctaaattttttagggaaatttcctgaattatcgttttctttctttttatgatcatac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
53697108 |
agttacatgatgacatcaatgatagatgaaagtattgattgtcctaaattttttagagaaatttcctgaattttcgttttctttctttttatgatcatac |
53697207 |
T |
 |
| Q |
201 |
agtttttg |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
53697208 |
agtttttg |
53697215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University