View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20523_high_16 (Length: 272)
Name: NF20523_high_16
Description: NF20523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20523_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 26568526 - 26568641
Alignment:
| Q |
1 |
caagtcctagttcaaatgccaaaagagaaaggaaaacaactatagcgcgacttaaggttctttgttttcggtccctttcaaggctcatgtctgtttctta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26568526 |
caagtcctagttcaaatgccaaaagagaaaggaaaacaactatagcgcgacttaaggttctttgttttcggtccctttcaaggctcatgtctgtttctta |
26568625 |
T |
 |
| Q |
101 |
tttttgttcctagatc |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
26568626 |
tttttgttcctagatc |
26568641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 174 - 246
Target Start/End: Original strand, 26568699 - 26568771
Alignment:
| Q |
174 |
ttttagtcttggatcccctacagcggctgcatggcgcagtagttgtggggatcgttagatctggagagcgaga |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26568699 |
ttttagtcttggatcccctacagcggctgcatggcgcagtagttgtggggatcgttagatctggagagagaga |
26568771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University