View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20523_high_24 (Length: 214)
Name: NF20523_high_24
Description: NF20523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20523_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 56 - 199
Target Start/End: Complemental strand, 24147234 - 24147092
Alignment:
| Q |
56 |
tttggattaacatttggttaaaatcaattatactcaaatatatgcatgtcaaattcaattttatattattaagatgaattttttactaatccaaaaacaa |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24147234 |
tttggattaacatttggttaaaatcaattatcctcaaatatatgcatgtcaaattcaattttatattattaagatgaat-ttttactaatccaaaaacaa |
24147136 |
T |
 |
| Q |
156 |
aaccaaacgtacaagattaattttaacatggttgcatatataaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24147135 |
aaccaaacgtacaagattaattttaacatggttgcttatataaa |
24147092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University