View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20523_low_11 (Length: 314)
Name: NF20523_low_11
Description: NF20523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20523_low_11 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 11 - 314
Target Start/End: Complemental strand, 3338112 - 3337809
Alignment:
| Q |
11 |
ctggattatgcggtcaaccccatgccaacttaactacactctgtactctttctttctccatccattatatgcaccaaacctcaccaacaaatatcaacac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338112 |
ctggattatgcggtcaaccccatgccaacttaactacactctgtactctttctttctccatccattatatgcaccaaacctcaccaacaaatatcaacac |
3338013 |
T |
|
| Q |
111 |
ttcatcgtctcaattataacaagtcaattaggcacctgtgattaataaataacttgtttatcatgttatccctattatatattgaatttctcttcaagtt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338012 |
ttcatcgtctcaattataacaagtcaattaggcacctgtgattaataaataacttgtttatcatgttatccctattatatattgaatttctcttcaagtt |
3337913 |
T |
|
| Q |
211 |
tgttgagccctagtttgccattcaaagaatattgaataatttagcacgcatgaaaagtaccgcatataaaacaaatgttattatagttataaaatcgacc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3337912 |
tgttgagccctagtttgccattcaaagaatattgaataatttagcacgcatgaaaagtaccgcatataaaacaaatgttattatagttataaaatcgacc |
3337813 |
T |
|
| Q |
311 |
tgta |
314 |
Q |
| |
|
|||| |
|
|
| T |
3337812 |
tgta |
3337809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University