View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20524_high_13 (Length: 249)
Name: NF20524_high_13
Description: NF20524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20524_high_13 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 142 - 249
Target Start/End: Complemental strand, 45866328 - 45866221
Alignment:
| Q |
142 |
gtctttaagttcaaaaacatatggtgtgtgtatttggagtttgattcttgattttcttaagctatagttttcaaattctgtgtttttgcttcagcgaagt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45866328 |
gtctttaagttcaaaaacatatggtgtgtgtatttggagtttgattcttgattttcttaagctatagttttcaaattctgtgtttttgcttcagcgaagt |
45866229 |
T |
|
| Q |
242 |
cttggttg |
249 |
Q |
| |
|
|||||||| |
|
|
| T |
45866228 |
cttggttg |
45866221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 9 - 93
Target Start/End: Complemental strand, 45866461 - 45866377
Alignment:
| Q |
9 |
agatgaatatcatgaaaatggaagaaaaaggtcttgatcctttatataccaatgactcatactccctattgaattgcaggacttg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45866461 |
agatgaatatcatgaaaatggaagaaaaaggtcttgatcctttatataccaatgactcatactccctattgaattgcaggacttg |
45866377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 64; Significance: 4e-28; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 150 - 245
Target Start/End: Complemental strand, 4055076 - 4054981
Alignment:
| Q |
150 |
gttcaaaaacatatggtgtgtgtatttggagtttgattcttgattttcttaagctatagttttcaaattctgtgtttttgcttcagcgaagtcttg |
245 |
Q |
| |
|
|||||||||||||| |||||||| |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
4055076 |
gttcaaaaacatattgtgtgtgtttttggatattgataattgattttcttaagctatagttttcaaattctgtgtttttgctgcagccaagtcttg |
4054981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 26 - 91
Target Start/End: Original strand, 17403855 - 17403920
Alignment:
| Q |
26 |
atggaagaaaaaggtcttgatcctttatataccaatgactcatactccctattgaattgcaggact |
91 |
Q |
| |
|
||||||||||||||| | ||| ||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
17403855 |
atggaagaaaaaggtttggattcttcgcataccaatgactcatactccctatcgaattgcaggact |
17403920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 189 - 236
Target Start/End: Original strand, 17404023 - 17404070
Alignment:
| Q |
189 |
ttgattttcttaagctatagttttcaaattctgtgtttttgcttcagc |
236 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17404023 |
ttgattttcgtaagctatagttttcaaattctgtacttttgcttcagc |
17404070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University