View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20524_high_3 (Length: 481)
Name: NF20524_high_3
Description: NF20524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20524_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 4e-67; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 215 - 404
Target Start/End: Complemental strand, 20571881 - 20571692
Alignment:
| Q |
215 |
tccaataagaaaagatgaagtatgtgtttggaaacctggctagttagaaatttccacgtttcgaagcgtttttaccgtgaaaattgagaagctacaaaaa |
314 |
Q |
| |
|
|||||| | |||||||||| |||||||||||||||||| || ||||||||||||| | |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20571881 |
tccaatgaaaaaagatgaaatatgtgtttggaaacctgactggttagaaatttccgcatttcgaagcgtttttaccgtgaaaattgagaagctaaaaaaa |
20571782 |
T |
 |
| Q |
315 |
gcagcatcaatctaaatgccggtttttcttatctccaccgcttcaacaaacacgtacaagaaaaatgtcgtcataaaaattattcaaaat |
404 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||| ||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
20571781 |
gcagcatcaatctaaacaccgatttttcttatccccaccacttcaacaaacacgtaccaaaaaaatgtcgtcataaaaattattcaaaat |
20571692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 20 - 68
Target Start/End: Complemental strand, 20571995 - 20571947
Alignment:
| Q |
20 |
tttatatcttcaacatgttttaatctcaaattaaaatcatttaaacacc |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20571995 |
tttatatcttcaacatgttttaatctcaaattaaaatcatttaaacacc |
20571947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 419 - 463
Target Start/End: Complemental strand, 20571618 - 20571574
Alignment:
| Q |
419 |
tgttgttgaaaattcgctgatctccaaaacgtgatgtgacctccc |
463 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20571618 |
tgttgttgaaaattcgctgatctccaaaacgtgatgtgacctccc |
20571574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 65; Significance: 2e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 239 - 367
Target Start/End: Original strand, 12776482 - 12776610
Alignment:
| Q |
239 |
tgtttggaaacctggctagttagaaatttccacgtttcgaagcgtttttaccgtgaaaattgagaagctacaaaaagcagcatcaatctaaatgccggtt |
338 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||| | |||| ||| ||||||||||||| |||||||||||||| ||||||| | |||| || ||| |
|
|
| T |
12776482 |
tgtttggaaacccggctagttagaaatttccgcgttacaaagcaatttcaccgtgaaaattgggaagctacaaaaagtagcatcattgtaaacgcgtgtt |
12776581 |
T |
 |
| Q |
339 |
tttcttatctccaccgcttcaacaaacac |
367 |
Q |
| |
|
|||| ||||||||||||||||||||||| |
|
|
| T |
12776582 |
tttcacatctccaccgcttcaacaaacac |
12776610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 36618566 - 36618607
Alignment:
| Q |
282 |
gtttttaccgtgaaaattgagaagctacaaaaagcagcatca |
323 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36618566 |
gttttcaccgtgaaaattgagaagctacaaaaagtagcatca |
36618607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University