View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20524_high_8 (Length: 326)
Name: NF20524_high_8
Description: NF20524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20524_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 308
Target Start/End: Original strand, 1792391 - 1792699
Alignment:
| Q |
1 |
gcacttccccaaattgacctgaaataaaacacnnnnnnnggttgcataatttatgcaaaaactcacaattcccataaggcatgaaactttgcaaaaaagg |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1792391 |
gcacttccctaaattgacctgaaataaaacacaaaaaaaggttgcataatttatgcaaaaactcacaattcccataaggcatgaaactttgcaaaaaagg |
1792490 |
T |
 |
| Q |
101 |
catggaagcttatacaaatttgcataacacttaagtacgaaaatgataaagatatcattgaatcacac-nnnnnnngtcttttattcttgggactttctt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1792491 |
catggaagcttatacaaatttgcataacacttaagtacgaaaatgataaagatatcattgaatcacacttttttttgtcttttattcttgggactttctt |
1792590 |
T |
 |
| Q |
200 |
aatcgttgtcaaatttagaggaaaacatgggtaaacgtggcaatgacaaaacccttggctcaaagaatgtgcaaaacacaaataactccttgtgcttcac |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1792591 |
aatcgttgtcaaatttagaggaaaacatgggtaaacgtggcaatgacaaaacccttggttcaaagaatgtgcaaaacacaaataactccttgtgcttcac |
1792690 |
T |
 |
| Q |
300 |
ccccttgat |
308 |
Q |
| |
|
||||||||| |
|
|
| T |
1792691 |
ccccttgat |
1792699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University