View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20525_high_19 (Length: 330)
Name: NF20525_high_19
Description: NF20525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20525_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 328
Target Start/End: Complemental strand, 1792698 - 1792370
Alignment:
| Q |
1 |
tcaagggggtgaagcacaaggagttatttgtgttttgcacattctttgagccaagggttttgtcattgccacgtttacccatgttttcctctaaatttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1792698 |
tcaagggggtgaagcacaaggagttatttgtgttttgcacattctttgaaccaagggttttgtcattgccacgtttacccatgttttcctctaaatttga |
1792599 |
T |
|
| Q |
101 |
caacgattaagaaagtcccaagaataaaagacnnnnnnn-gtgtgattcaatgatatctttatcattttcgtacttaagtgttatgcaaatttgtataag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1792598 |
caacgattaagaaagtcccaagaataaaagacaaaaaaaagtgtgattcaatgatatctttatcattttcgtacttaagtgttatgcaaatttgtataag |
1792499 |
T |
|
| Q |
200 |
cttccatgccttttttgcaaagtttcatgccttatgggaattgtgagtttttgcataaattatgcaaccnnnnnnngtgttttatttcaggtcaatttgg |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
1792498 |
cttccatgccttttttgcaaagtttcatgccttatgggaattgtgagtttttgcataaattatgcaacctttttttgtgttttatttcaggtcaatttag |
1792399 |
T |
|
| Q |
300 |
ggaagtgcttttcaatattcttcgacatc |
328 |
Q |
| |
|
||||||||||||||||||||||| ||||| |
|
|
| T |
1792398 |
ggaagtgcttttcaatattcttcaacatc |
1792370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University