View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20525_high_5 (Length: 426)
Name: NF20525_high_5
Description: NF20525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20525_high_5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 417; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 417; E-Value: 0
Query Start/End: Original strand, 2 - 426
Target Start/End: Complemental strand, 52926221 - 52925797
Alignment:
| Q |
2 |
ctgttgctgctgaaaccaacccacaggatgctcccgttccaccctgcatttccactcttgaaggtggtcttgttcaacttgctattgaagttgaggatcg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52926221 |
ctgttgctgctgaaaccaacccacaggatgctcccgttccaccctgcatttccactcttgaaggtggtcttgttcaacttgctattgaagttgaagatcg |
52926122 |
T |
 |
| Q |
102 |
tgctcaccgctccgcaatcaccagagtaaatgctgatgatgttcgtgtcactgtagctgctcctgctgctcgtggagaagctaacaatgaacttttggag |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926121 |
tgctcaccgctccgcaatcaccagagtaaatgctgatgatgttcgtgtcactgtagctgctcctgctgctcgtggagaagctaacaatgaacttttggag |
52926022 |
T |
 |
| Q |
202 |
tttatgggaaaggttttaggtttaagattgagtcaaatgactcttcagagaggatggaataacaagtcaaagcttcttgtggtcagtcatgtcttcttca |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926021 |
tttatgggaaaggttttaggtttaagattgagtcaaatgactcttcagagaggatggaataacaagtcaaagcttcttgtggtcagtcatgtcttcttca |
52925922 |
T |
 |
| Q |
302 |
acttaaccaagtagtaagtatttctcaacaaacatatatactaacgctaattttcaccatcatttcaggtggaggatctcactgctagacaagtttatga |
401 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52925921 |
acttaaccaagtagtaagtatttctcaacaaacatatatactaatgctaattttcaccatcatttcaggtggaggatctcactgctagacaagtttatga |
52925822 |
T |
 |
| Q |
402 |
gaaacttttggaggctgtgcaacct |
426 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
52925821 |
gaaacttttggaggctgtgcaacct |
52925797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University