View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20526_high_1 (Length: 609)
Name: NF20526_high_1
Description: NF20526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20526_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 355 - 586
Target Start/End: Original strand, 52471832 - 52472063
Alignment:
| Q |
355 |
tggaccgtaaatgcaaaagagtcttctaatggttaccttttggtatcccataaattaaacaacgttgacagccaaggatctgtgttagaaatgaaggttc |
454 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
52471832 |
tggaccgtaaatgcaaaagagtcttctaaaggttaccttttggtatcccataaattaaacaatgttgaaagccaaggatctgtgttagaaatgaaggaga |
52471931 |
T |
 |
| Q |
455 |
aggatatggtccaagtgttggattgaggcccttggaagcccaacattgggagagaatataggctgagtgtggtggtacagtgagacgtgttttgtgatct |
554 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52471932 |
acacaatggtccaagtgttggattgaggcccttggaagcccaacattgggagagaatataggctgagtgtggtggtacagtgagacgtgttttgtgatct |
52472031 |
T |
 |
| Q |
555 |
cttttaacaccgtatagtaactgtcatgtctg |
586 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
52472032 |
cttttaacaccgtatagtaactgtcatgtctg |
52472063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000002; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 176 - 258
Target Start/End: Original strand, 41485478 - 41485559
Alignment:
| Q |
176 |
attgctgaaaaagttagtaaaagtacaacagcggaaggtaattgaagccattaatcaagttctagttcatgtaagacgttatt |
258 |
Q |
| |
|
||||||||||||||||||||||||| || | | |||||||||||| |||||||| ||| | |||||||| |||||| ||||| |
|
|
| T |
41485478 |
attgctgaaaaagttagtaaaagtaacac-gggaaaggtaattgaatccattaattaaggtttagttcatataagactttatt |
41485559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 373 - 422
Target Start/End: Complemental strand, 38794036 - 38793987
Alignment:
| Q |
373 |
gagtcttctaatggttaccttttggtatcccataaattaaacaacgttga |
422 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||| || ||| ||||| |
|
|
| T |
38794036 |
gagtcctctaatggttaccttttggtatcgcataaatcaatcaatgttga |
38793987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 100 - 137
Target Start/End: Original strand, 41483324 - 41483361
Alignment:
| Q |
100 |
tattttacttttgtaggccattatgcatgatgtgattg |
137 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
41483324 |
tattttacttttgtaggccgttttgcatgatgtgattg |
41483361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 160 - 236
Target Start/End: Complemental strand, 12024582 - 12024507
Alignment:
| Q |
160 |
tgaggatttggtgatgattgctgaaaaagttagtaaaagtacaacagcggaaggtaattgaagccattaatcaagtt |
236 |
Q |
| |
|
||||||||| ||||| ||| |||||||||||||||||||| | || |||||||||||||| ||||| |||||||| |
|
|
| T |
12024582 |
tgaggatttagtgatagttggtgaaaaagttagtaaaagta-acaagaggaaggtaattgaaaccattcatcaagtt |
12024507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University