View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20526_high_5 (Length: 273)
Name: NF20526_high_5
Description: NF20526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20526_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 36 - 156
Target Start/End: Complemental strand, 2049067 - 2048946
Alignment:
| Q |
36 |
taatacgggtgttgcttaaaaaaggtgtattcctggcctttattttctagttaatatcttgatattttaatttgaatgtccaaaatga-ggggaaatgcg |
134 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2049067 |
taatacaggtgttgcttaaaaaaggtgtgttcctagcctttattttctagttaatatcttgatattttaatttgaatgtccaaaatgagggggaaatgcg |
2048968 |
T |
 |
| Q |
135 |
cataacacgtgaccatataata |
156 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2048967 |
cataacacgtgaccatataata |
2048946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 168 - 245
Target Start/End: Complemental strand, 2048688 - 2048611
Alignment:
| Q |
168 |
gtgcaaacaattatgtgatgcaaaatagacaaaataacatctacattctcgatcagagtgagattaagtattcttttc |
245 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
2048688 |
gtgcaaacaattgtgtgatgcaaaatagacaaaataacatctacattctcgatcagagtgagataaaatattcttttc |
2048611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University