View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20527_high_6 (Length: 238)
Name: NF20527_high_6
Description: NF20527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20527_high_6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 53211240 - 53211453
Alignment:
| Q |
18 |
atttatttgatgttcaatatttacacttttaaataatatgagttttcaaaaactcacaccggttactgaacagactcttcctcgagtataagcccatata |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||| ||| ||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
53211240 |
atttatttgatgttcaatatttgcacttttaagtaatacgagctttcaaaaactcacaccggttaccgaacagactcttcctcgagtataagtccatata |
53211339 |
T |
 |
| Q |
118 |
aattcattatccactccttcaagtgaaaactttttcatataacatatacttatattggcactgtcgactgtcgttgtcgattcactcaatgggacacgcc |
217 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
53211340 |
aattcattatccattccttcaagcgaaaacttttttatataacatatacttatattggc-------actgtcgttgtcgattcactcaatgggacacgtc |
53211432 |
T |
 |
| Q |
218 |
acttgaccacgtttgttagaa |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
53211433 |
acttgaccacgtttgttagaa |
53211453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University