View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20528_low_10 (Length: 225)

Name: NF20528_low_10
Description: NF20528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20528_low_10
NF20528_low_10
[»] chr5 (1 HSPs)
chr5 (6-225)||(8467885-8468104)


Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 6 - 225
Target Start/End: Original strand, 8467885 - 8468104
Alignment:
6 tcatttccttcacaggtttaggctccaccggcatttcaacatcatcaacttctccggaagcagacataactaatgaaacttttttactgagtagtgagtt 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8467885 tcatttccttcacaggtttaggctccaccggcatttcaacatcatcaacttctccggaagcagacataactaatgaaacttttttactgagtagtgagtt 8467984  T
106 agatgaaacggtaacttgtgttaaatagttagataataattagtttgctattggtagagtccagtgatggaggttgccaacgtggcaaagagatatcaag 205  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8467985 agatgaaacggtaacttgtgttaaatagtaagataataattagtttgctattggtagagtccagtgatggaggttgccaacgtggcaaagagatatcaag 8468084  T
206 aacgtacacgtggtgtcaat 225  Q
    ||||||||||||||||||||    
8468085 aacgtacacgtggtgtcaat 8468104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University