View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20528_low_6 (Length: 287)
Name: NF20528_low_6
Description: NF20528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20528_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 1 - 164
Target Start/End: Complemental strand, 5423538 - 5423376
Alignment:
| Q |
1 |
ttatctatataccaatataactagtcttttatgattatgacacattttatcttcattggtatttaagatttctgaaaatcaaattggtatttttctctct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5423538 |
ttatctatataccaatataactagtcttttatgattatgacacattttatcttgattggcatttaagatttctgaaaatcaaattggtatttttctct-- |
5423441 |
T |
 |
| Q |
101 |
ctctaacgaccacacatatatatgcg-nnnnnnnncttttcaataaccaattcaaatatgcactc |
164 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5423440 |
ctctaacgaccacacatatatatgcgtttttttttcttttcaataaccaattcaaatatgcactc |
5423376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 239 - 287
Target Start/End: Complemental strand, 5423309 - 5423262
Alignment:
| Q |
239 |
ttagtttcctctccattcttactgacttgatgcgtaaatatttcatttc |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
5423309 |
ttagtttcctctccattcttactgacttgatgcat-aatatttcatttc |
5423262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University