View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20529_low_18 (Length: 250)
Name: NF20529_low_18
Description: NF20529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20529_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 42 - 240
Target Start/End: Original strand, 41027814 - 41028005
Alignment:
| Q |
42 |
atgggttgggaaaagtcttgctgtcaagaaattttggcaaggtttgtggttgaatttaggtggtgttatcttaggttaagaatttaggagttgtgttagg |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
41027814 |
atgggttgggaaaagtcttgctgtcaagaaattttggcaaggtttatggttgaatttaggtggtgttaacttaggttaagaatttaggacttgtgttagg |
41027913 |
T |
 |
| Q |
142 |
tagttaactgtttcatggtgattggtgattctgttatgtaactactagtcttaatgaacaagtgtttatgattttagattttgaaatttactttctctg |
240 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41027914 |
tagttaactgtttca-------tggtgattctgttatgtaactactagtcttaatgaacaagtgtttatgattttagattttgaaatttactttctctg |
41028005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University