View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20529_low_20 (Length: 236)
Name: NF20529_low_20
Description: NF20529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20529_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 19 - 120
Target Start/End: Original strand, 41275893 - 41275993
Alignment:
| Q |
19 |
gtgttggcatacaattgcatcccttatttccatcattccatgtgctaagccaatcaattacaagagttgagttgttagttttgttgggcttggaagtagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41275893 |
gtgttggcatacaattgcatcccttatt-ccatcattccatgtgctaagccaatcaattacaagagttgagttgttagttttgttgggcttgggagtagt |
41275991 |
T |
 |
| Q |
119 |
at |
120 |
Q |
| |
|
|| |
|
|
| T |
41275992 |
at |
41275993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 115 - 178
Target Start/End: Original strand, 41276081 - 41276147
Alignment:
| Q |
115 |
tagtatcccacacttaagtgtcttagattctttcttgtctttcttttc---cgttttccacaagaag |
178 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41276081 |
tagtatcccacatttaagtgtcttagattctttcttgtctttcttttccgtcgttttccacaagaag |
41276147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 220
Target Start/End: Original strand, 41276195 - 41276228
Alignment:
| Q |
187 |
tggatttaacaatctcctttcaatatattttctt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41276195 |
tggatttaacaatctcctttcaatatattttctt |
41276228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University