View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2052_low_2_N (Length: 384)
Name: NF2052_low_2_N
Description: NF2052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2052_low_2_N |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 30 - 368
Target Start/End: Complemental strand, 24776055 - 24775710
Alignment:
| Q |
30 |
attggagggtgttatgggtttggtggaggttttgagggaggtgacggaaagggtgtttaggtacctctggaagagtccgacacctt----------ggcc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
24776055 |
attggagggtgttatgggtttggtggaggttttg-gggaggtggaggaaagggtgtttaggtacctctggaagagtccaacaccttctaaggtggtggcc |
24775957 |
T |
 |
| Q |
120 |
ttttattggaagttgctttgggacca-attccgaccnnnnnnnnnntccttgcaactcataagattattgatcctttggtggcgacagactgtgtctggt |
218 |
Q |
| |
|
|||| |||||||||||||||||||| ||||| ||| ||||||||||| |||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
24775956 |
ttttcttggaagttgctttgggaccgcattcctacccaaaaaaa---ccttgcaactcgtaagattattgaccctttggtggcgacagactgtgtgtggt |
24775860 |
T |
 |
| Q |
219 |
gtgaaggagaggtggaaacatcattacatttgtttttacattgtgacttcgcctatagggtgtggacgaagattttggggtggcttggagtccaatttat |
318 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24775859 |
gtgaaggagaggtggaaacatcattaaatttgtttttacattgtgacttcgcgtatagggtgtagacgaagattttggggtggcttggagttcaatttat |
24775760 |
T |
 |
| Q |
319 |
aacccctcagaatctgttctatcacttagaatgatggttcaaagcggcaa |
368 |
Q |
| |
|
|| |||||| |||||||| |||||||||||||| |||||| ||||||||| |
|
|
| T |
24775759 |
aatccctcacaatctgttttatcacttagaatgttggttcgaagcggcaa |
24775710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University