View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20530_high_34 (Length: 232)
Name: NF20530_high_34
Description: NF20530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20530_high_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 80 - 215
Target Start/End: Original strand, 28368080 - 28368215
Alignment:
| Q |
80 |
taacatttgccaccctacccccacactgtggaactttacatggttctcaagtttgacagaagacaagtcctttctattaatccaccacaaataatataaa |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28368080 |
taacatttgccaccctacccccacactgtggaactttacatggttctcaagtttgacagaagacaagtcctttccattaatccaccacaaataatataaa |
28368179 |
T |
 |
| Q |
180 |
agtactaaacatgccgcatgctccagactttatatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
28368180 |
ggtactaaacatgccgcatgctccagattttatatt |
28368215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University