View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20530_low_18 (Length: 369)
Name: NF20530_low_18
Description: NF20530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20530_low_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 16 - 364
Target Start/End: Original strand, 2021298 - 2021646
Alignment:
| Q |
16 |
caacaaggttatatagattcatcaaagtgtttcttgtactttcaattgttgctttggttgttgaaatcattgctcattttaatcaatggaatttgcatgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2021298 |
caacaaggttatatagattcatcaaagtgtttcttgtactttcaattgttgctttggttgttgaaatcattgctcattttaatcaatggaatttgcatgt |
2021397 |
T |
|
| Q |
116 |
gattcaaccttgggaagttaagaatcttttgcaatggttttatatggtttggatttcttttagagaagattatgttgctcctttggttttgtttgtgtcc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2021398 |
gattcaaccttgggaagttaagaatcttttgcaatggttttatatggtttggatttcttttagagaagattatgttgctcctttggttttgtttgtgtca |
2021497 |
T |
|
| Q |
216 |
aaattttgtattgttttgttcttgattcaatctttggatcggcttgttctttgtcttggatgcttttggatcaaggttaagaagttgaagcctatgattg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2021498 |
aaattttgtattgttttgttcttgattcaatctttggatcggcttgttctttgtcttggatgcttttggatcaaggttaagaagttgaagcctatgattg |
2021597 |
T |
|
| Q |
316 |
atgatgatgcttatgatgttgaggatcctttgagctttcctatgcttct |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2021598 |
atgatgatgcttatgatgttgaggatcctttgagctttcctatggttct |
2021646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University