View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20530_low_25 (Length: 265)
Name: NF20530_low_25
Description: NF20530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20530_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 34876712 - 34876471
Alignment:
| Q |
1 |
ctctccaggagcactggtgagtaatcaattactgtaaatttaatctctaactaannnnnnnnnnnn---aagttttcgttacacgatccaaagagattca |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
34876712 |
ctctccaggagcactggtgagtaatcaattactgtaactttagtctctaactaatttttatttttttttaagttttcgttacacgatccatagagattca |
34876613 |
T |
|
| Q |
98 |
gctcttgtcgattcatctgcttatattagttatccttctgtcacatatactgttattattctaactgtgttgataaatttggtgcgacggtgacatattt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| ||||||||||||||| |
|
|
| T |
34876612 |
gctcttgtcgattcatctgcttatattagttatccttctgtcacatatactgttatta-----------ttgataattttggtgtgacggtgacatattt |
34876524 |
T |
|
| Q |
198 |
atgcagtaggagaatttgacataatcatggcaactatgaggggttcttctgtg |
250 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34876523 |
atgcagaaggagaatttgacataatcatggcaactatgaggggttcttctgtg |
34876471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University