View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20530_low_29 (Length: 243)
Name: NF20530_low_29
Description: NF20530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20530_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 224
Target Start/End: Complemental strand, 3361083 - 3360877
Alignment:
| Q |
18 |
aatgttactgaacatgcaccagacaatggtatcataagggagggaggaggtgaagattttgaaacttcagaaaactctcaaagctcaaaacttctttttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3361083 |
aatgttactgaacatgcaccagacaatggtatcataagggagggaggaggtgaagattttaaaacttcagaaaactctcaaagctcagaacttctttttg |
3360984 |
T |
 |
| Q |
118 |
agcttcatgaaaagggatcagatgatcccgaaaaacccgaggttgagaaagctcggtactttatcttagttcaagaagcatttatttgctattcctgcct |
217 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3360983 |
agcttcatgtaaagggatcggatgatcccgaaaaacccgaggttgagaaagctcagtactttatcttagttcaagaagcatttatttgctattcctgcct |
3360884 |
T |
 |
| Q |
218 |
ctcttat |
224 |
Q |
| |
|
||||||| |
|
|
| T |
3360883 |
ctcttat |
3360877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University