View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20530_low_30 (Length: 240)
Name: NF20530_low_30
Description: NF20530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20530_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 11 - 225
Target Start/End: Complemental strand, 40813086 - 40812871
Alignment:
| Q |
11 |
gagtgagaagaaataatttgctggtacccaccccttaataatagaacaaaaatctgaaaaataatggctacggggataactaatagcatcaaccaaggag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40813086 |
gagtgagaagaaataatttgctggtacccaccccttaataacagaacaaaaatctgaaaaataatggctacggggataactaatagcatcaaccaaggag |
40812987 |
T |
 |
| Q |
111 |
tctaactcaaagatggtg-ttgtctagagacccaactcttgcacccatctcaacgcttgcaacaaacgcagaccatcaccatctctggttcctttcctct |
209 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40812986 |
tctaactcaaagatggtgtttgtctagagacccaactcttgcacccatctcaacgcttgcaacaaacgcagaccatcaccatctctggttcctttcctct |
40812887 |
T |
 |
| Q |
210 |
tattaattatatatgt |
225 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40812886 |
tattaattatatatgt |
40812871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University