View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20530_low_31 (Length: 240)
Name: NF20530_low_31
Description: NF20530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20530_low_31 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 10 - 240
Target Start/End: Complemental strand, 7134416 - 7134184
Alignment:
| Q |
10 |
acatcatcaacattgccc--tccttttcttataaccaatttacaaattcacactacacattgatacataaagacttaaacactcataaaactattctatg |
107 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7134416 |
acatcatcaacattgcccaatccttttcttataaccaatttacaaattcacactacacattgatacataaagacttaaacactcataaaactattctatg |
7134317 |
T |
 |
| Q |
108 |
tgagacttgtaactttcaatgtttaacaaaacacaggctgatttttgggatactagattctttcttcattcttcagttttattatgtttgagttccttat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7134316 |
tgagacttgtaactttcaatgtttaacaaaacacaggctgatttttgggatactagattctttcttcattcttcagttttattatgtttgagttccttat |
7134217 |
T |
 |
| Q |
208 |
tcataatgaaatatcaatcttatttctatcact |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7134216 |
tcataatgaaatatcaatcttatttctatcact |
7134184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 147 - 183
Target Start/End: Complemental strand, 11954597 - 11954561
Alignment:
| Q |
147 |
gatttttgggatactagattctttcttcattcttcag |
183 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
11954597 |
gatttttgggataatagattctttcttcattgttcag |
11954561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University