View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20531_low_12 (Length: 281)
Name: NF20531_low_12
Description: NF20531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20531_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 18 - 275
Target Start/End: Complemental strand, 19856982 - 19856725
Alignment:
| Q |
18 |
atgatgactgtgtttggaaaatgttatgatttctttgatggtgatggttttgagcttgaggagttggtgagtgaaggttatgagctgttgggtgttttta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19856982 |
atgatgactgtgtttggaaaatgttatgatttctttgatggtgatggtgttgagcttgaggagttggtgagtgaagggtatgagctgttgggtgttttta |
19856883 |
T |
 |
| Q |
118 |
actggagtgatcattttcctcttctgggttggttggatttgcagggtgttaggaaaaggtgtagagctttggtgaaaaaggttaatacttttgttggaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19856882 |
actggagtgatcattttcctcttctgggttggttggatttgcagggtgttaagaaaaggtgtagagctttggtgacaaaggttaatacttttgttggaaa |
19856783 |
T |
 |
| Q |
218 |
gataatagaggagcataagatgaagagaatgtctgaaggaagggctatagttggtgat |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19856782 |
gataatagaggagcataagatgaagagaatgtctgaaggaagggctatagttggtgat |
19856725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University