View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20531_low_13 (Length: 269)
Name: NF20531_low_13
Description: NF20531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20531_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 14 - 207
Target Start/End: Complemental strand, 45541090 - 45540897
Alignment:
| Q |
14 |
tactggggcatttgtattgtttctagcaaatacatgagatggaaagacatattgggcattagtcacattttcacttggacgctccatcaattgtatcggc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45541090 |
tactggggcatttgtattgtttctagcaaatacatgagatggaaagacatattgggcattagtcacattttcacttggacgctccatcaattgtatcggc |
45540991 |
T |
 |
| Q |
114 |
gggttttgtatctctggtcctttaattttgtggtgttctatgttttgattagacgaagttggcgtggagtgttctgctacatctgaatcttgat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45540990 |
gggttttgtatctctggtcctttaattttgtggtgttctatgttttgattagacgaagttggcgtggagtgttctgctacatctgaatgttgat |
45540897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 200 - 252
Target Start/End: Complemental strand, 45540826 - 45540774
Alignment:
| Q |
200 |
atcttgatttgcattacctgtgacatttatagaagcgcacgtttgttcttggt |
252 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45540826 |
atcttgatttgcattacttgtgacatttatagaagcgcacgtttgttcttggt |
45540774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University