View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20531_low_15 (Length: 248)
Name: NF20531_low_15
Description: NF20531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20531_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 51314041 - 51314262
Alignment:
| Q |
18 |
caacaaaagcaaaagggggaatggttatcaggaagtttcaagccagagaatttcattccaggtcttgttattggtttcatttgtggcttgttgattgatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51314041 |
caacaaaagcaaaagggggaatggttatcaggaagtttcaagccagagaatttcattccaggtcttgttattggtttcatttgtggcttgttgattgatt |
51314140 |
T |
|
| Q |
118 |
tatctaagccaactagaaatcacttgtccaacaaaatcttctcatcgaccaagcttcaaaaccaactctctgtctcaagtaatggtgctgatcaaggact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
51314141 |
tatctaagccaactagaaatcacttgtccaacaaaatcttctcatccaccaagcttcaaaaccaactctctgtctcaagtaatggtgctgatcaagaact |
51314240 |
T |
|
| Q |
218 |
taaaatggtttgttcatctcat |
239 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
51314241 |
taaaatggtttgttcatttcat |
51314262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University