View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20533_low_2 (Length: 377)
Name: NF20533_low_2
Description: NF20533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20533_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 18 - 114
Target Start/End: Complemental strand, 11399134 - 11399038
Alignment:
| Q |
18 |
ctaaccaacttccaaaacagttgctaacaaatctaactgttttaactaacttgaattaaaatacaacagtttttgatggtgagaagcgttgcatcca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| ||||||||| |
|
|
| T |
11399134 |
ctaaccaacttccaaaacagttgctaacaaatctaactgttttaactaacttgaattaaaatacaacagttttttatcgtgagaagctttgcatcca |
11399038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 36612762 - 36612695
Alignment:
| Q |
18 |
ctaaccaacttccaaaacagttgctaacaaatctaactgttttaactaacttgaattaaaatacaaca |
85 |
Q |
| |
|
|||||||||||| |||||||||| |||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36612762 |
ctaaccaacttctaaaacagttgacaacaaacctaactgttttaactaacttaaattaaaatacaaca |
36612695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 43 - 85
Target Start/End: Original strand, 43695224 - 43695266
Alignment:
| Q |
43 |
aacaaatctaactgttttaactaacttgaattaaaatacaaca |
85 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43695224 |
aacaaacctaactgttttaactaacttgaattaaaatacaaca |
43695266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University